Biopolymery 2018

INFO
STADISTICS
RECORDS
Title of test:
Biopolymery 2018

Description:
biochemistry, biopolymers

Author:
AVATAR

Creation Date:
15/05/2018

Category:
Science
Click 'LIKE' to follow the bests test of daypo at facebook
Last comments
No comments about this test.
Content:
Který z nákresů zobrazuje molekulu prolinu nalézanou v proteinech? Prostorové uspořádání tentokrát neřešte. A B C D E F G.
Na obrázku je cyklický peptid. Očíslovány jsou jednotlivé stavební jednotky. Co platí? Peptid vzniká při translaci a dodatečně je cyklizován. 9=L-Ala 2=L-Trp 7=L-Lys 9=D-Ala 12=D-Ser 1=L-Arg 13=L-Glu 3=L-Asn 14=L-Tyr.
Spektrofotometrie proteinů - co je pravda? Množství světla, které projde kyvetou, závisí lineárně na koncentraci rozpuštěné látky. U proteinů se měří absorpce většinou v UV oblasti. Při 220 nm absorbuje v proteinech peptidová vazba. Čím je aromatická molekula větší, tím více absorbuje. Při 300 nm absorbuje v proteinech téměř výhradně tryptofan. Množství světla, které projde kyvetou, závisí exponenciálně na koncentraci rozpuštěné látky. Absorbance vzorku je ovlivněna koncentrací látky a její molekulární strukturou. Při 220 nm absorbuje v proteinech téměř výhradně tryptofan. Při 280 nm absorbují aromatické aminokyseliny.
Gelová elektroforéza proteinů s použitím SDS (SDS-PAGE). Co platí? Rozděluje proteiny hlavně podle jejich tvaru. Rozděluje proteiny hlavně podle jejich náboje. Využívá gelu z mořských řas. Většinou se při (před) ní proteiny denaturují. SDS většinou naruší proteinové komplexy. SDS proteiny stabilizuje v nativní konformaci. Rozděluje proteiny podle počtu podjednotek. Rozděluje proteiny hlavně podle molekulové hmotnosti. Rozděluje proteiny podle posttranslačních modifikací. SDS proteinům uděluje rovnoměrný kladný náboj.
Co platí o stavbě jednoduchých volných atomů? Přechod elektronu na nižší energetickou hladinu je doprovázen emisí elektromagnetického záření. Atomy absorbují a emitují světlo o zcela přesných vlnových délkách, které vypovídají o struktuře atomu. Nejpevněji jsou v atomu vázány elektrony, které jsou nejdál od jádra, protože mají nejnižší energii. Atomy vzácných prvků mají vysokou hodnotu první ionizační energie, proto snadno tvoří ionty. Při zaplňování jedné určité slupky elektrony se postupně zvětšuje velikost atomu. Elektrony v orbitalech mohou získávat vyšší energii například absorpcí fotonů. Hundovo pravidlo říká, že degenerované orbitaly se zaplňují vždy dvojicí elektronů s opačným spinem. Valenční elektrony všech prvků jsou v orbitalech typu d.
Stavba atomu. Co platí? Všechna jádra atomů jsou tvořena protony a neutrony. Většina hmotnosti atomu je tvořena elektronovým obalem. Energie elektronu se zvyšuje, pokud je dál od jádra. Největší hustota elektronů je v těsné blízkosti jádra. Náboj elektronu je asi -1,602 C.
Podívejte se na atomy uhlíku označené šipkami. Jaký typ hybridizace se uplatňuje na atomech X a Z? Jaký typ vazby je mezi nimi? sp - sp2, vazba sigma. sp3 - sp2, vazba sigma. sp2 - sp3, vazba pi. sp3 - sp3, vazba sigma. sp3 - sp, vazba sigma. sp3 - sp2, vazba pi. sp2 - sp2, vazba sigma. sp - sp2, vazba pi.
Který z nákresů zobrazuje molekulu asparaginu nalézanou běžně v proteinech? Zaměřte se i na prostorové uspořádání. A B C D E F.
Podívejte se na atomy uhlíku označené šipkami. Jaký typ hybridizace se uplatňuje na atomech X a Z? Jaký typ vazby je mezi nimi? sp3 - sp3, vazba sigma. sp3 - sp2, vazba pi. sp3 - sp, vazba sigma. sp - sp2, vazba pi. sp - sp, vazba sigma. sp3 - sp2, vazba sigma. sp2 - sp2, vazba sigma. sp2 - sp3, vazba pi.
Které tvrzení o aminokyselinách je pravdivé? Nejméně polární jsou GLU, ASP, LYS. Nejvíce polární jsou PHE, ILE, VAL. Největší je TRP. Kladně nabité jsou ARG a LYS. Nejmenší jsou GLY, ALA, VAL. Glycin vlastně není aminokyselina. Záporně nabité jsou ASN a GLN.
Co je na obrázku? Co platí? Difraktogram krystalu DNA. Dihedrální úhly proteinu, který má převážně sekundární strukturu alfa-helixu. Dihedrální úhly proteinu, který obsahuje prakticky pouze glycin. Ramachandran diagram. Dihedrální úhly proteinu, který má převážně sekundární strukturu beta-listu. Dihedrální úhly v DNA konformace A. Zobrazení konformace DNA. Body značí konkrétní pozorování, kontury pak běžně obsazovaná místa. Dihedrální úhly v DNA konformace B. Difraktogram krystalu proteinu.
Co nejvíce stabilizuje sekundární strukturu alfa-helixu v proteinech? Co dále platí? Vodíkové můstky mezi postranními řetězci aminokyselin. Vodíkové můstky mezi C=0 a N-H skupinami. Na jednu otočku helixu je přesně 5 aminokyselin. Hydrofóbní interakce postranních řetězců aminokyselin. Na jednu otočku helixu připadají přesně 3 aminokyseliny. Na dvě otočky helixu připadá asi 7 aminokyselin. Vodíkové můstky mezi peptidem a molekulami vody. Elektrostatické interakce postranních řetězců.
Co je na obrázku? Co platí? Tripeptid Val-Val-Val Tripeptid Gly-Ala-Asp Tripeptid Ala-Ala-Ala Rotace kolem vazeb 1 a 2 mění dihedrální úhly fí a psí. 2 Značí vazbu, kolem které je možná rotace. Obdélníky značí rigidní planární části struktury. 1 Značí vazbu, kolem které je možná rotace. 1 a 2 značí vazby, kde není možná rotace, kvůli rezonanci.
Který prvek v základním stavu má elektronovou konfiguraci 1s2 2s2 2p4(2,1,1)? kyslík uhlík síra fosfor dusík.
Co platí o izoelektrickém bodu (pI) glycinu? Jeho hodnota je asi 2. Jeho hodnota je udávána v Coulombech. Pokud je glycin uprostřed proteinu, pak má hodnotu >9. Jeho hodnota je asi 9. Je to průměr hodnot pKa skupin -COOH a -NH3+. Jeho hodnota je asi −1,6×10^(−19) C. Jeho hodnota je asi 6. Je to hodnota pH, kdy má glycin nejvyšší elektrický náboj. Je to hodnota pH, kdy se glycin nepohybuje při elektroforéze.
Prohlédněte si jednotlivé nakreslené struktury. Soustřeďte se i na prostorové uspořádání vazeb. Vodíky vázané na uhlík mohou v nákresech chybět. Která z nich NENÍ běžná aminokyselina v proteinech? A B C D E F G H.
Pozorování Cirkulárního Dichroismu na proteinech... Vypovídá o sekundárních strukturách v proteinu. Znamená rozdílnou schopnost absorpce lineárně a cirkulárně polarizovaného světla. Měří se většinou ve viditelné oblasti spektra. Vypovídá hlavně o terciální struktuře proteinu. Neumožňuje sledovat sbalování ani denaturaci proteinu. Znamená rozdílnou schopnost absorpce levotočivého a pravotočivého světla.
Co se může stát s purinovou bází v DNA, když je methylována v pozici N7? Často dojde k depurinaci. Může dojít k její odštěpení z deoxyribosy. Báze vynutí ve svém okolí konformaci Z. Methylová skupina se snadno schová dovnitř šroubovice. Například u thyminu vždy vyvolá tvorbu thyminového dimeru. Báze začne párovat s 5'-methylcytosinem.
Co je na obrázku? Jaké báze zde párují? Protonovaný Adenin a imino Cytosin. Imino tautomer Adeninu a Cytosin. Guanin a imino tautomer Cytosinu. Guanin a keto tautomer Cytosinu. Keto forma Adeninu a Cytosinu. Deprotonovaný Adenin a Thymin. Adenin a imino tautomer Cytosinu. Adenin a Inosin. Guanin a enol tautomer Cytosinu. Adenin a imino tautomer Uracilu.
Co jsou to rotamery? Struktury v proteinech nacházené s různou pravděpodobností na různých místech - např. v krystalech. Například L-valin a D-valin. Různé možné pozice postranního řetězce aminokyselin. Například L-glycin a D-glycin.? Viry používané k amplifikaci požadované sekvence. Malé monomerní proteiny, které se projevují rychlou difúzí. Oligomerní symetrické proteinové komplexy vytvářející válcovité struktury v membránách.
Které ze zobrazených bází jsou velmi běžné v DNA? A B C D E F G H.
Jaký typ "stacking" interakce se nejvíce uplatňuje v dvoušroubovici DNA mezi patry bází? A B C D.
Co platí o nejčastějších RNA vlásenkách (viz moodle)? Mohou v centrální části vytvářet interakci U-G. Jsou tvořeny např. sekvencí GGACGGCGGUCC. Zaujímají částečně konformaci podobnou A-DNA. Mohou být stabilizovány také vodíkovým můstkem mezi cytosinem a fosfátem. Obsahují vždy alespoň 5 nespárovaných bazí. Kromě centrální části jsou tvořeny téměř pravidelným palindromem. Jsou tvořeny např. sekvencí AAACUUAAGUCC. Jsou tvořeny např. sekvencí UGACUUAAGUCA. Jsou tvořeny např. sekvencí GGACUUCGGUCC.
Prohlédněte model a rozhodněte, která tvrzení mohou být správná. Neočekávejte záludnosti. Atomy dusíku a kyslíku jsou tmavší, než uhlík. Atomy vodíku nejsou zobrazeny. "4" je guanin. "3" značí deoxyribózu. Molekula je protein calmodulin (zobrazeno pouze 8 aminokyselin). Molekula je guanosin-5',3'-tetrafosfátu (ppGpp). "3+4" je histidin. Molekula je cytidin-5'-difosfát-3'-difosfát. Na fosfátové skupiny "1" je vázán jeden kationt "2". "2" je ATP vázané na DNA-helikázu ("1+1+1+1+3+4"). "3" značí ribózu. "4" je tryptofan.
Co platí pro dvě molekuly, které jsou v prostoru vůči sobě náhodně orientované? Uvažujme podélné osy obou molekul. Pokud je nalezneme častěji pod úhlem 20°, než pod úhlem 40°, pak spolu asi nějak interagují. Nejčastěji budou k sobě orientovány pod takzvaným magickým úhlem. Skoro nikdy nebudou rovnoběžně. Nejsou k sobě nijak vázány, tedy budou zaujímat zcela libovolné úhly se stejnou pravděpodobností. S největší pravděpodobností jsou k sobě na kolmo (pod úhlem 90°).
Co platí o molekule kyseliny difosforečné? Spoluutváří cukr-fosfátovou kostru nukleových kyselin. Vzniká při štěpení restrikčními enzymy používanými v laboratoři. Je částí DNA, váže se na 3' a 5' konce nukleosidů. Má tvar trojboké pyramidy. Vykazuje "pnutí" kvůli blízkým atomům kyslíku. Je součástí pyrolysinu. Má pKa asi 10. Má lomený tvar s atomem fosfátu uprostřed.
Co platí o chemické vazbě? Jednoduchá kovalentní vazba bývá typu pí. Při vzniku vazby nesmí dojít k obsazení žádného antivazebného orbitalu. Jednoduchá kovalentní vazba bývá typu sigma. Vazby se účastní jen elektrony nejblíže jádru. Hustota elektronů dvou vázaných atomů je zvýšená mezi jádry. Vzniká vždy mezi atomy s rozdílnou elektronegativitou. Vazby se účastní elektrony vnějších vrstev. Trojná vazba je kratší, než vazba dvojná. Dvojná kovalentní vazba bývá typu sigma + pí. Jednoduché vazby pí se účastní celkem 4 "laloky" orbitalů-p (dva a dva s opačnou fází).
Na obrázku je thymin + adenin + thymin. Bíle je zobrazen vodík, šedě uhlík a dusík, tmavě kyslík. Co dále platí? Vpravo Hoogsteenovo párování (v obrázku Z). Vlevo Watson-Crickovo párování (v obrázku X). Struktura velmi často nacházená v RNA. Vlevo párování "wobble" (v obrázku X). Vpravo párování "wobble" (v obrázku Z). Vlevo Hoogsteenovo párování (v obrázku X). .
DNA a RNA se chovají v bazickém prostředí rozdílně. Jak? Proč? Dvouřetězcové uspořádání chrání DNA před degradací. Methylovaná DNA je ze všech forem DNA a RNA nejméně odolná. RNA se degraduje na cyklické nukleotidy a nakonec i na lineární. DNA se v hydroxidech vždy depurinuje. 3'-OH skupina na DNA zajišťuje stabilitu vlákna. DNA se degraduje na směs cyklických nukleotidů. DNA je kyselejší a proto snáz odolává hydroxidům. 2'-OH skupina na RNA vyvolává štěpení cukr-fosfátové kostry.
Který z nákresů zobrazuje molekulu isoleucinu nalézanou v proteinech? A B C D E F G.
V proteinech se převážně vyskytují L-aminokyseliny. Níže vyberte pravdivá tvrzení. Neplatí pro prolin, protože nemá primární amin. Všechny L-aminokyseliny stáčejí rovinu polarizovaného světla, ale na různé strany. Všechny L-aminokyseliny stáčejí rovinu polarizovaného světla doprava. Glycin se nedá charakterizovat jako L a D forma, protože není opticky aktivní. Vyjímkou je glycin, ten je v proteinech vždy jako D-glycin. Všechny L-aminokyseliny stáčejí rovinu polarizovaného světla doleva. D-aminokyseliny jsou v buňkách také, ale nemohou se zabudovávat při translaci.
Co platí o N-glykosidické vazbě v DNA? V Z-DNA se střídá anti-syn-anti-syn konfigurace v jednom vlákně. V B-DNA bývá purin v konfiguraci syn a pyrimidin v anti. Báze je vždy v konfiguraci syn. Báze je vždy v konfiguraci anti. Adenin je prakticky vždy v konfiguraci anti. Cytosin je vždy v konfiguraci syn. .
V oblastech DNA bohatých na A-T páry platí: DNA-vazebné proteiny sem mohou velmi těžko nasedat. Tyto sekvence nikdy nenacházíme v regulačních částech genů. Adenin a Thymin zde mohou vytvářet vodíkové můstky v jednom vlákně. Rozplétají se zde částečně antiparalelní vlákna. Objevuje se zde někdy změna konformace B-DNA a A-DNA. Může zde snadno docházet k ohybu obou vláken. Adenin a Thymin zde vytvářejí kvadruplex.
Co je na obrázku? Hoogsteenovo párování bází. Guanin a Cytosin. Cytosin a Uracil. Párování bází nacházené např. v tRNA a mRNA. Inosin a Adenin. Párování bází typu "wobble". Inosin a Cytosin. Inosin a Uracil. Párování typické pro DNA.
Co je na obrázku? Uracil a Inosin. Inosin a Adenin. Párování bází nacházené např. v tRNA a mRNA. Uracil a Guanin. Párování typické pro DNA. Cytosin a Guanin. Párování bází typu "wobble". Hoogsteenovo párování bází. Cytosin a Inosin. Guanin a Cytosin.
Pro konformaci Z u nukleových kyselin platí: Je častá, pokud se v sekvenci opakuje GCGCGC. Jde o pravidelnou strukturu, ale dvě nad sebou ležící patra se vzájemně konformací nepodobají. Střídají se v ní konfigurace syn a anti. Jde o levotočivou dvoušroubovici. Je častá, pokud se v sekvenci opakuje GAGAGA. Vyskytuje se často v duplexu RNA-DNA. Jde o strukturu, ve které jsou fosfátové skupiny velmi vzdálené, díky interakcím s kationty. Vazba proteinů ji vždy přeměňuje na konformaci B. Je vyvolána vysokou koncentrací aniontů. Jde o pravotočivou dvoušroubovici.
Podívejte se na sekvenci rozpoznávanou enzymem EcoRI. Co platí? Tato sekvence se nachází pouze ve virech. Náhodná DNA bude štěpena na fragmenty dlouhé v průměru asi 4096bp. Enzym se nedá použít pro analýzu RFPL, protože rozpoznává moc dlouhou sekvenci. Náhodná DNA bude štěpena na fragmenty dlouhé v průměru asi 6536bp. Enzym rozpoznává sekvenci dlouhou 12bp. Náhodná DNA bude štěpena na fragmenty dlouhé v průměru asi 1024bp. V genomu Escherichia coli není žádné zásahové místo, jinak by byla genomová DNA v buňce rozštěpena. Enzym produkuje takzvaně lepivé konce. Enzym produkuje takzvaně tupé konce. Enzym rozpoznává sekvenci dlouhou 6bp.
Co je na obrázku? Atypické párování Adeninu s Uracilem. Atypické párování Guaninu s Uracilem. Párování v DNA vynucující vzácnou rotaci purinu okolo glykosidické vazby. Atypické párování Adeninu s Thyminem. Párování běžné v Z-DNA. Struktura nacházená v telomerách. Běžné párování Adeninu s Uracilem. Párování v dsRNA vynucující rotaci pyrimidinu okolo glykosidické vazby.
Na obrázku je záznam z ultracentrifugace po různé době sedimantace (t0, t1, t2, t3). Co dále platí? Malé molekuly sedimentují vždy rychleji než velké. Na densitogramu vpravo je vidět postupování rozhraní vzorku směrem ke dnu. Nemůže se jednat o sedimentaci DNA, ta by v CsCl vždy stoupala ode dna. Šířka rozhraní je ovlivněna difúzním koeficientem látky. Vlevo jsou snímky kyvety, kde tmavě je znázorněna absorbance vzorku. Vzorek je polydisperzní, protože se šířka rozhraní v čase liší. Jedná se centrifugaci v gradientu CsCl a látka nakonec doputuje do jedné úzké zóny. Na svislé ose grafu je koncentrace nebo absorbance vzorku. Kyvety nejsou přesně kvádrové, aby v nich byl konstantní hydrostatický tlak. Koncentrace látky ve středu kyvety se v čase snižuje, jak se u hladiny hromadí její agregáty.
Která ze struktur níže je součástí DNA (a zároveň chybí v RNA)? A B C D E F G H.
Co platí o restrikčních endonukleázách používaných při klonování? Štěpí pouze kruhovou DNA. Štěpí DNA na fragmenty vždy delší, než 1000 párů bazí. Rozpoznávají palindromatické úseky dvouvláknové DNA. Často vyžadují kationty kovů pro svou aktivitu. Působí vždy ve formě monomerů. Rozpoznávají většinou sekvence delší, než 10 párů bazí, zejména pokud obsahují hodně guaninu. Při reakci in vitro štěpí každou DNA jen jednou, neboť ji při štěpení methylují. Štěpí pouze methylovanou DNA. Štěpí pouze jednovláknové palindromatické sekvence. Štěpí DNA na různě dlouhé fragmenty. Délka fragmentu závisí na délce rozpoznávané sekvence.
Podívejte se na záznam z pyrosekvenování. Písmena dole značí přidaný deoxyribonukleotid, výchylka křivky směrem nahoru znamená nárůst luminiscence. Jaká je sekvence sekvenovaného (tedy komplementárního) vlákna? TCCCCACCGAAA TCGTGA AGGCACT AGGGGTGGCTTT AGTGCT TGACTGACTGA AGTCAGTCAGT AAAGCCACCCCT.
Co platí o nadobrátkách v přírodní DNA? Udrží se pouze u lineárních forem DNA. Dají se zrušit přidáním molekul DAPI. Napomáhají rozvíjení dvojvlákna. Dají se rozvinout vmezeřením Ethidia do malého žlábku. Jedná se o záporné nadobrátky. Napomáhají replikaci. Vyvolávají kondenzaci chromosomální bakteriální DNA. Usnadňují translaci. Dají se pozorovat v elektronovém mikroskopu. Vytváří je topoizomeráza I.
Zde je elektroforéza (pohyb zleva doprava) fragmentů chemického štěpení DNA v přítomnosti piperidinu (podle Maxama a Gilberta). V první linii byl použit hydrazin a 2M NaCl. Ve druhé linii jen hydrazin. Ve třetí linii dimethylsulfát v pH 4. Ve čtvrté linii dimethylsulfát v pH 7. Jaká byla původní sekvence DNA? GCGCGATCGCT TCGCGATAGCC TGAGAATAGCT TCGCGATAGTC GCGCGATATCT GCGCGATAGGT TCGCGATAGCT TCGCGCTAGCT TCACAGTGACT CTGTGACAGTC.
Na obrázku je plazmid s restrikčními místy pro BamHI a EcoRI. Během pokusu bylo provedeno několik štěpení s jednolivými enzymy nebo jejich kombinacemi. Výsledky štepění byly rozděleny na elektroforéze vpravo spolu s markerem molekulových hmotností. Kb značí tisíce párů bazí. Které tvrzení je správné? Linie IV je štěpení pouze BamHI. Linie II je štěpení EcoRI + BamHI. Linie IV je štěpení EcoRI + BamHI. Linie III je štěpení pouze BamHI. Linie II je štěpení pouze EcoRI. Linie III je štěpení pouze EcoRI. Linie III je štěpení EcoRI + BamHI. Linie II je štěpení pouze BamHI. Linie V je štěpení EcoRI + BamHI. Linie IV je štěpení pouze EcoRI.
Jaká je sekvence tohoto peptidu (řazeno od N-konce)? Ala-Arg-Arg-Gln-Met-Glu-Glu Asp-Ala-Arg-Arg-Gln-Met-Glu-Glu Asp-Cys-Asn-Arg-Arg-Ala Glu-Glu-Met-Gln-Arg-Arg-Gly Nedá se lineárně zapsat, protože jde o větvenou molekulu. Glu-Glu-Cys-Asn-Gln-Gln-Val-Ser Gly-Glu-Met-Asp-Arg-Arg-Gly-Asp-Glu Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp Gly-Glu-Glu-Met-Asp-Arg-Arg-Val-Asp-Glu Asp-Asp-Cys-Asn-Arg-Arg-Ala-Glu.
Jaké interakce je uplatňují mezi DNA a proteinem HU? Dochází k velmi specifické vazbě tryptofanu-adenin DNA. Dochází k interakci prolinu a báze DNA. Beta-hairpin HU se váže do malého žlábku DNA. Monomer HU se váže do velkého žlábku DNA. Prolin v HU se váže kovalentně na guanin. HU je silně záporně nabitý a využívá Ca2+ pro vazbu na DNA. HU váže pouze jednovláknovou DNA. Arginin v HU je přitahován fostátovou skupinou DNA. HU rozpoznává přesné palindormy. Kovalentní vazba mezi C-koncem HU a fosfátem DNA.
Co platí o sedimentační konstantě? Na její hodnotu má vliv objem a tvar molekuly. s=M*(1-V*d)/(N*f), kde M je molekulová hmotnost, V objem molekuly, d její hustota, f koeficient tření. Udává se v [m/s]. s=v/r*omega^2, kde v je rychlost klesání, r poloměr rotoru, omega úhlová rychlost. Dá se změřit pohyblivostí rozhraní studovaných molekul při centrifugaci. Na její velikost má vliv hustota okolního roztoku. Měří se v gradientu sacharózy. Zjišťuje se pomocí izokinetické centrifugace. Zjišťuje se pomocí izopyknické centrifugace.
Ze sekvenace krátkých fragmentů genomové DNA jste získali tyto sekvence: TTCGAGCTTCA, AGCATGCTGCA, GTCATGCTTAGGCTATAAATGC. Při modifikaci podmínek potom GGCTATAAATGCTTCGAGCTTCA, AGCATGCTGCAGTCATGCTTA (jednalo se o stejný původní kus DNA). Jaká byla původní sekvence zkoumaného úseku? AGCATGCTGCAGTCCTTCGAGCTTCA AGCATGCTGCAGTCATGCTTAGGCTATAAATGCTTCGAGCTTCA AGCATGCTGCAGTCATGCTCGAGCTTCA TGCTGCAGTCATGCTTAAAACCTGGCTATAAATGCTTCGAGCTT AGCATGCTGCAGTCATGCTTAGGCTATAAAT AGCGCAGTCATAGGCTATTCGAGCTTCAGCAGTCCTCATGCTCG AGCATCTATAAATGCTTCGAGCTTCA.
Jaké síly působí na molekulu během sedimentace? Co platí o ultracentrifugaci? RCF (relativní odstředivá síla v [g])=0,00001*r*RPM^2 kde r je poloměr rotoru v cm, RPM otáčky za minutu. Třecí síla - působí vždy směrem k hladině. Třecí síla - je závislá na druhé mocnině rychlosti pohybu molekuly směrem ke dnu. Třecí síla - na konci izopyknické centrifugace prakticky nepůsobí. Vztlak - působí více u dna kyvety, pokud v ní vznikl gradient hustoty. Vztlak - působí na všechny molekuly. Odstředivá síla - je vždy tím větší, čím je molekula blíže ke dnu. Vztlak - působí pouze na molekuly, které mají nižší hustotu, než okolní roztok. Na molekulu působí u dna hydrostatický tlak v řádu stovek bar. Odstředivá síla - je konstantní v čase, pokud je konstantní rychlost otáček.
Při sekvenaci pomocí fosfodiesterázy hadího jedu byly získány různé fragnemty obsahující následující množství jednotlivých nukleotidů (seřazeno podle velikosti RNA): 2G+3C+3A+2U 1G+3C+3A+2U 1G+2C+3A+2U 1G+2C+2A+2U 1G+2C+1A+2U 1G+2C+1A+1U G+C+A+U C+A+U C+U. Sestavte původní sekvenci RNA. Která z následujících to byla? CAGCUAACGU CUAGCUAACG UCAGCUAACU UAAGCUAACG UCAGCUAAAG AGCUAACGUC UCAGCUAACG UCAGCUAUCG CUCAGCUAAC UUAGCUAACG.
Jak se dá značit DNA při Sangerově metodě sekvenace DNA pro následnou detekci? Stejně jako u PCR se DNA nikdy neznačí - stačí absorpční měření. Fluorescenčně na použitých primerech. Hledaná sekvence se rozpozná po hybridizaci primerů s jednovláknovou RNA. DNA se značit nemusí, protože inkorporace nukleotidu se detekuje uvolněným PPi. Fluorescenčně na dideoxy-nukleotidech. Radioaktivně na gama-fosfátu dideoxy-nukleotidů. Radioaktivně pomocí deoxy-nukleotidů, pokud běží všechny reakce ve stejné nádobě. Pomocí EtBr, pokud běží reakce ve čtyřech různých nádobách.
Proč/jak se váží proteiny SSB na DNA? Dochází k interakci fenylalaninu a báze DNA. SSB jsou bazické, DNA kyselá. SSB jsou silně hydrofóbní a DNA hydrofilní. SSB jsou nabité kladně a DNA záporně. Mezi SSB a DNA vzniká kovalentní vazba. SSB jsou nabité záporně a DNA kladně. DNA i SSB jsou silně hydrofóbní. Mezi těmito molekulami dochází k několika "stacking" interakcím. Dochází k interakci tryptofanu a báze DNA.
Co se dá vyčíst z UV-absorpčního spektra nukleové kyseliny? Čistota vzorku. Podíl absorbancí při 260 nm a 280 nm by měl být okolo 2. Pokud je podíl nízký, je vzorek kontaminován např. proteiny. Počet opakování určité sekvence v jednom vlákně. Pokud budeme sledovat změny spektra v různých teplotách, můžeme zjistit podíl nativní a denaturované DNA. Pokud zjistíme velmi vysokou absorbanci při 360 nm, jde o jednovláknovou DNA. Podíl RNA a DNA ve vzorku. Sekvenční komplexita. Silná absorpce při 220 nm naznačuje přítomnost dvouvláknové RNA. Konformace DNA. Koncentrace vzorku.
Co platí pro izopyknickou centrifugaci? Malé molekuly vytvoří širší zóny, než molekuly velké. Rozdělí molekuly DNA podle obsahu GC párů. Slouží k určení sedimentační konstanty. Umožní výpočet sedimentačního koeficientu. Velké molekuly při ní sedimentují ke dnu vždy rychleji než malé. Využívá gradientu velmi viskózních látek (cukrů). Velké molekuly při ní sedimentují ke dnu vždy pomaleji než malé. Umožnila prokázat semikonzervativní replikaci DNA. Umožní dělení molekul podle jejich vznášivé hustoty. Probíhá v například v gradientu CsCl.
Co je všechno potřeba pro Sangerovu metodu sekvenace? Velké množství sekvenované RNA. Pro samotnou sekvenaci stačí jediná kopie zkoumané DNA. Zařízení, které periodicky mění teplotu směsi. RNA-dependentní DNA polymeráza. Celkem 8 primerů. ddATP. Předem namnožená sekvenovaná DNA. Přesná znalost střední části amplifikované sekvence. dATP. ATP.
Report abuse Terms of use
We use cookies to personalize your experience. If you continue browsing you will be accepting its use. More information.